memo7 memo7
  • 03-04-2016
  • Mathematics
contestada

Please answer the question from the attachment.

Please answer the question from the attachment class=

Respuesta :

rana12 rana12
  • 03-04-2016
so you have to make the percent into a decimal so it would be o.15 
you have to multiply it by the how much she earned which is 23.
so 0.15 X 23=48.75
Answer Link

Otras preguntas

Canon law preserved Roman laws has its origins in
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
The distance of Venus to the sun must be: (= equal, > greater than, < less than) < 1 A.U. > 1 A.U. = 1 A.U.
What is The mass of earth is 5.97 X 10^24 kilogram? Express your answer In scientific notation.
Why did anti-imperialists oppose U.S. expansion?
Please help with number 1 and 2
i scanned it pls help​
Solve the equation 3x +10=40. x=
help is in neeeeeeeeeeeed
9. Why can "taxi seats" be a problem for elephants? Support your answer with evidence from the text.