atifgujar atifgujar

02-05-2019
Spanish

contestada

Help with Spanish questions

Help with Spanish questions class=

Respuesta :

arely2009 arely2009

02-05-2019

Answer: There is 3 words missing I'll try to help. But if you have the lesson about it that may help too.

Explanation:

Ver imagen arely2009

Answer Link

Otras preguntas

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?

what's the ph of citric acid

In a standard normal curve, what percentile corresponds to a z-score of 2.0?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What was a major effect of the agricultural revolution in the united states during the late 1800's?

Which country use tax brackets as part of their tax system? canada australia south africa all of the above?

I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;

Application of force with movement is called _______________ exercise.

who invented the theory of relativity