er6inx4naoibeccaptal
er6inx4naoibeccaptal er6inx4naoibeccaptal
  • 04-06-2016
  • Computers and Technology
contestada

Which window allows you to view and change your computer's system information and settings?
a. Folder
b. My Computer
c. Control Panel
d. Windows Explorer

Respuesta :

renate1halleen
renate1halleen renate1halleen
  • 04-06-2016
I think Its control panel
Answer Link
seenee
seenee seenee
  • 04-06-2016
C. Control Panel allows you to change system settings
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
f(x) = x3 + 1; {−2, −1, 0, 1, 2}
how was southern Africa connected to the trans-sharan trade system
(01.02MC)Point A is located at negative 4 over 6 and point B is located at negative 1 over 6. What is the distance between points A and B?
Which statement is true about the graph of the line x=2
How can I say this in Korean? I only know how to say half of it lol“I was supposed to study abroad in Korea next semester but, corona is ruining my plans.”미리 고마
which particle diagram represents a mixture of three substances
3. What is the message of this cartoon? What is the cartoonist saying about the United States?
What percentage of the atoms in the same sample of plutonium-238 will have changed to another isotope after 263.1 years?
If 1 kg = 2.2 pounds, convert 77 kg into pounds