sabrinataveras sabrinataveras
  • 03-10-2016
  • Mathematics
contestada

what expression is equivalent to 3(2x-5)+4?

Respuesta :

InternetWalrus InternetWalrus
  • 03-10-2016
3(-3x)+4 is equivalent
Answer Link
Аноним Аноним
  • 03-10-2016
the equivalent expression is (6x - 15) +4. You get the answer by using the associative property, and solving first; 3 times 2x, which is 6x, then 3 times 5, which is 15.
Answer Link

Otras preguntas

Graph the six terms of a finite series where a1 = -3 and r = 1.5.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Please help solve, thanks in advance!
what rule does static electricity follow
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
How do you put allele in a sentence
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Companies raise funds to expand their business by