sklefos sklefos

04-07-2022
Physics

contestada

which group on the periodic table wants to gain 2 electrons?

Respuesta :

Jingzuo Jingzuo

04-07-2022

Answer:

Periodic

Explanation:

The groups in the periodic table that want to gain electrons are groups; 15, 16 and 17. The members of these groups are mostly nonmetals.

Answer Link

Otras preguntas

An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos

Identify the consequences—both long-term and short-term—of the vietnam war.

find the greatest common divisor of 9 and 27

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the value of c?

what does a light year measure

(60) Points HeLp asap 5 questions

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

Need help asappp plzz helppp

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors