nickieGel8bydolf5e nickieGel8bydolf5e
  • 03-03-2017
  • History
contestada

How the erie canal improved water transportation?

Respuesta :

Аноним Аноним
  • 06-03-2017
The Erie Canal improved water transportation by connecting the Great Lakes so one boat didn't have to cross land when traveling.Brainiest Please!
Answer Link

Otras preguntas

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
does a human body use neon???
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Which body tissue or organ contains the most mitochondria?
how would u form a superlative for the adverb widely
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?